epsB [2019-02-19 20:22:31]

extracellular polysaccharide synthesis, protein tyrosine kinase, phosphorylation of EpsE

Locus: BSU34360

Isoelectric point: 9.92

Molecular weight: 24.53 kDa

Protein length: 227 aa

Gene length: 684 bp

Function: biofilm formation

Product: protein tyrosine kinase

Essential: no

Synonyms: yveL

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Protein modification → Protein kinases
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Matrix polysaccharide synthesis
• Groups of genes → Phosphoproteins → Phosphorylation on a Tyr residue

Gene

Coordinates: 3,528,462 3,529,145

The protein

Catalyzed reaction/ biological activity

• phosphorylation of EpsE, to stimulate EpsE activity and biofilm formation PubMed

Protein family

• BY kinase, see the Bacterial Protein Tyrosine Kinase Database)

Paralogous protein(s)

• PtkA

Modification

• autophosphorylated on Tyr-225 and Tyr-227 PubMed

Structure

• 2VED (CapB, the homolog in Staphylococcus aureus) PubMed

Expression and Regulation

Operons

• Genes: epsA-epsB-epsC-epsD-epsE-epsF-epsG-epsH-epsI-epsJ-epsK-epsL-epsM-epsN-epsO
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • RemA: activation, PubMed, in RemA regulon
  • AbrB: repression, PubMed, in AbrB regulon
  • SinR: anti-activation, (prevents binding of RemA) PubMed, in SinR regulon
  • EAR riboswitch: processive antitermination, in EAR riboswitch

  Regulation

  • repressed by SinR PubMed

  Additional information

  • induction by sequestration of SinR by SinI or SlrA PubMed
  • expression is increased in rsiX mutants PubMed

Biological materials

Mutant

• MGNA-A072 (yveL::erm), available at the NBRP B. subtilis, Japan
• GP1518 (aphA3) PubMed, available in Jörg Stülke's lab
• GP1519 (epsA-epsB, aphA3) PubMed, available in Jörg Stülke's lab
• BKE34360 (epsB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CTTTTTTCTAAAGATCACTC, downstream forward: _UP4_TAGTTTTTGTAAAGGTGATG
• BKK34360 (epsB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CTTTTTTCTAAAGATCACTC, downstream forward: _UP4_TAGTTTTTGTAAAGGTGATG

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH) PubMed, available in Jrg Stlke's lab

FLAG-tag construct

• GP1541 epsB-FLAG 3x spc (based on pGP1331) available in Jrg Stlke's lab

Labs working on this gene/protein

• Richard Losick, Harvard Univ., Cambridge, USA homepage

References

Reviews

Loading

Original publications

Loading